Agilent pFB Vector Instruction Manual PDF

1 of 13
1 of 13

Summary of Content for Agilent pFB Vector Instruction Manual PDF

pFB and pFB-Neo Retroviral Vectors

Instruction Manual

Catalog #217563 (pFB Retroviral Vector) and #217561 (pFB-Neo Retroviral Vector) Revision C.0

For Research Use Only. Not for use in diagnostic procedures. 217561-12

LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement of this product. No other warranties of any kind, express or implied, including without limitation, implied warranties of merchantability or fitness for a particular purpose, are provided by Agilent. Agilent shall have no liability for any direct, indirect, consequential, or incidental damages arising out of the use, the results of use, or the inability to use this product.

ORDERING INFORMATION AND TECHNICAL SERVICES Email techservices@agilent.com

World Wide Web

www.genomics.agilent.com

Telephone Location Telephone

United States and Canada 800 227 9770

Austria 01 25125 6800

Benelux 02 404 92 22

Denmark 45 70 13 00 30

Finland 010 802 220

France 0810 446 446

Germany 0800 603 1000

Italy 800 012575

Netherlands 020 547 2600

Spain 901 11 68 90

Sweden 08 506 4 8960

Switzerland 0848 8035 60

UK/Ireland 0845 712 5292

All Other Countries Please visit www.agilent.com/genomics/contactus

PFB AND PFB-NEO RETROVIRAL VECTORS CONTENTS

Materials Provided .............................................................................................................................. 1

Storage Conditions .............................................................................................................................. 1

Introduction ......................................................................................................................................... 2

The pFB Vector ..................................................................................................................... 3

The pFB-Neo Vector ............................................................................................................. 4

pFB-Luciferase Control Vector ......................................................................................................... 5

Replication-Defective Retroviral Gene Transfer Systems ............................................................... 6

Biosafety Considerations .................................................................................................................... 6

Ligation of Vector and Insert ............................................................................................................. 7

Ligation Guidelines ............................................................................................................... 7

Ligation Protocol ................................................................................................................... 8

Recombination and Host Strains for Subcloning and Propagation ................................................ 9

Primers ................................................................................................................................................. 9

Preparation of Media and Reagents ................................................................................................ 10

References .......................................................................................................................................... 10

Supplemental References .................................................................................................................. 10

MSDS Information ............................................................................................................................ 10

pFB and pFB-Neo Retroviral Vectors 1

pFB and pFB-Neo Retroviral Vectors

MATERIALS PROVIDED Material provided

Quantity

Catalog #217561 Catalog #217563

pFB-Neo retroviral vector 10 g

pFB retroviral vector 10 g

pFB-Luciferase expression control vector 10 g 10 g

STORAGE CONDITIONS All components:20C

NOTICE TO PURCHASER FOR LABORATORY USE ONLY A license (from Promega for research reagent products and from The Regents of the University of California for all other fields) is needed for any commercial sale of nucleic acid contained within or derived from this product.

BIOSAFETY CONSIDERATIONS The host range of a retrovirus is determined not by the vector DNA but by the specific env gene used to construct the packaging cell line. Viruses produced from amphotropic or polytropic packaging lines are capable of infecting human cells. The National Institutes of Health has designated retroviral vectors, such as MMLV, as Biosafety Level 2. Appropriate caution should be used in the production and use of recombinant retrovirus. For more information see Biosafety in Microbiological and Biomedical Laboratories at www.nih.gov/od/ors/ds/pubs/ bmbl/contents.htm.

Revision C.0 Agilent Technologies, Inc. 2015.

2 pFB and pFB-Neo Retroviral Vectors

INTRODUCTION The Agilent pFB and pFB-Neo plasmid vectors for retroviral gene delivery and expression are derived from the Moloney murine leukemia virus (MMLV) and can be used to produce high titer viral stocks with MMLV- based packaging cell lines.1,2 Both vectors contain the bacterial origin of replication and ampicillin-resistance gene from pBR322, an extended MMLV packaging signal (+), and a multiple cloning site (MCS) located between the MMLV 5 and 3 long terminal repeat sequences (LTRs), see Figures 1 and 2. The pFB vector is a minimal MMLV-based vector that can accommodate larger inserts than pFB-Neo. The pFB vector does not contain any exogenous sequence other than the sequence of the MCS. The pFB-Neo vector differs from the pFB vector only by the presence of a cassette consisting of the internal ribosome entry site (IRES) from the encephalomyocarditis virus (EMCV) and the neomycin-resistance gene (neor). The open reading frame (ORF) for the neor gene is positioned downstream of the MCS and follows the IRES. A dicistronic message encoding the gene of interest and the neor gene is expressed from the viral promoter within the 5 LTR.

pFB and pFB-Neo Retroviral Vectors 3

The pFB Vector

Feature Nucleotide position

5-long terminal repeat (LTR) 209760

transcription initiation (clockwise) 616

splice donor 818822

+ extended viral packaging signal 7602046

gag gene (truncated) 12361723

splice acceptor 17511753

5 retro primer binding site 20082028

multiple cloning site 20572086

3 pFB primer binding site 21212101

3-long terminal repeat (LTR) 21632756

pBR322 origin of replication 32373904

ampicillin resistance (bla) ORF 40554912

FIGURE 1 Circular map and features for the pFB retroviral vector. The complete nucleotide sequence and list of restriction sites can be found at www.genomics.agilent.com.

EcoR ISal I Xho I Not IBamH I

GTCGACGAATTCGGATCCTCGAGCGGCCGC

pFB Multiple Cloning Site Region (sequence shown 20572086)

5' LTR transcription initiation (clockwise)

psi+

splice donor

splice acceptor

gag gene (truncated)

MCS 3' LTR

pBR322 ori

ampicillin

pFB 5.1 kb

4 pFB and pFB-Neo Retroviral Vectors

The pFB-Neo Vector

Feature Nucleotide Position

5-long terminal repeat (LTR) 209760

transcription initiation (clockwise) 616

splice donor 818822

+ extended viral packaging signal 7602046

gag gene (truncated) 12361723

splice acceptor 17511753

5 retro primer binding site 20082028

multiple cloning site 20572086

3 pFB primer binding site 21472127

internal ribosome entry site (IRES) 20932586

neomycin resistance ORF 27633557

3-long terminal repeat (LTR) 36174210

pBR322 origin of replication 46915358

ampicillin resistance (bla) ORF 55096366

FIGURE 2 Circular map and features for the pFB-Neo retroviral vector. The complete nucleotide sequence and list of restriction sites can be found at www.genomics.agilent.com.

EcoR ISal I Xho I Not IBamH I

GTCGACGAATTCGGATCCTCGAGCGGCCGC

pFB-Neo Multiple Cloning Site Region (sequence shown 20572086)

5' LTR

psi+ splice donor

splice acceptor

gag gene (truncated)

MCS

IRES

neomycin 3' LTR

pBR322 ori

ampicillin transcription initiation (clockwise)

pFB-Neo 6.6 kb

pFB and pFB-Neo Retroviral Vectors 5

pFB-LUCIFERASE CONTROL VECTOR The pFB-Luc plasmid vector (Figure 3), which contains the luciferase gene, is included with the vectors as an expression control. A retroviral vector expressing a reporter gene is useful for optimizing transfection efficiency, confirming viral production, as well as ascertaining whether or not a target cell line can be infected by a given viral stock.

Figure 3 Circular map for the pFB-Luc control vector. The complete nucleotide sequence and list of restriction sites can be found at www.genomics.agilent.com.

5' LTR transcription initiation (clockwise)

psi+ splice donor

splice acceptor

LUC 3' LTR

ampicillin

gag gene (truncated)pBR322 ori pFB-Luc

6.8 kb

6 pFB and pFB-Neo Retroviral Vectors

REPLICATION-DEFECTIVE RETROVIRAL GENE TRANSFER SYSTEMS Replication-defective retroviral vectors contain all of the cis elements required for transcription of a gene of interest and packaging of the transcripts into infectious viral particles.2 The retroviral vectors typically consist of an E. coli plasmid backbone containing a pair of viral LTRs between which the gene of interest is inserted. In order to generate infectious virus particles that carry the gene of interest, specialized packaging cell lines have been generated that contain chromosomally integrated expression cassettes for viral proteins Gag, Pol, and Env, all of which are required in trans for production of virus. After the packaging cell line is transfected with the vector DNA, either the supernatant is collected for transiently produced viral stocks, or stable viral producer cell lines are selected (provided the vector has an appropriate selectable marker). The supernatant is used to infect dividing target cells. Upon infection, the viral RNA molecule is reverse transcribed by reverse transcriptase (which is present in the virion particle), and the gene of interest, flanked by the LTRs, is integrated into the host DNA. Because the vector itself does not express viral proteins, once a target cell is infected, the LTR expression cassette is incapable of another round of virus production.

BIOSAFETY CONSIDERATIONS The host range of a retrovirus is determined not by the vector DNA but by the specific env gene used to construct the packaging cell line. Viruses produced from amphotropic or polytropic packaging lines are capable of infecting human cells. The National Institutes of Health has designated retroviral vectors, such as MMLV, as Biosafety Level 2. Appropriate caution should be used in the production and use of recombinant retrovirus. For more information see Biosafety in Microbiological and Biomedical Laboratories at www.nih.gov/od/ors/ds/pubs/ bmbl/contents.htm.

pFB and pFB-Neo Retroviral Vectors 7

LIGATION OF VECTOR AND INSERT

Ligation Guidelines Because the size of retroviral RNA that can be efficiently packaged is limited to ~11 kb (including the 5 and 3 LTRs),1 the size of the insert should be <8.4 kb for the pFB vector and <7.0 kb for the pFB-Neo vector. Inserts should include both initiation and stop codons. Design the insert to contain a Kozak sequence. A complete Kozak sequence includes CCACCATGG, although CCATGG, or the core ATG, is sufficient. Dephosphorylate the digested plasmid DNA with alkaline phosphatase prior to ligation with the insert DNA. If more than one restriction enzyme is used, the background can be reduced further by gel purification of the digested plasmid DNA. After gel purification, resuspend the DNA in TE buffer (see Preparation of Media and Reagents) or water. For ligation, the ideal ratio of insert-to-vector DNA is variable; however, a reasonable starting point is 2:1 (insert:vector), measured in available picomole ends. This ratio is calculated as follows:

660 pairs base ofnumber 10 2 DNA of gramends/micro picomole

6

=

8 pFB and pFB-Neo Retroviral Vectors

Ligation Protocol

1. Prepare the following two experimental and three control ligation reactions by adding the following components in order to separate 0.5-ml microcentrifuge tubes:

Component

Insert controla

Digest controlb

Phosphatase controlc

Test I 2:1

Test II X:1

Prepared vector (10 ng/l)

1 l 1 l 1 l 1 l

Prepared insert (10 ng/l)

X l X l X l

10 mM rATP (pH 7.0) 0.5 l 0.5 l 0.5 l 0.5 l 0.5 l

10 ligase bufferd 0.5 l 0.5 l 0.5 l 0.5 l 0.5 l

T4 DNA ligase (4 U/l) 0.5 l 0.5 l 0.5 l 0.5 l

Double-distilled water to a final volume of 5 l

X l 3.0 l 2.5 l X l X l

a Lacks the prepared vector and controls for contamination of the insert by vector DNA. b Lacks the prepared insert and T4 DNA ligase and controls for residual undigested

vector. c Lacks the prepared insert and controls for the effectiveness of the alkaline phosphatase

treatment; should result in significantly fewer colonies than the test plates. d See Preparation of Media and Reagents.

2. Mix the ligation reactions gently.

3. Incubate the ligation reactions overnight at 16C.

4. Transform the appropriate competent bacteria with 12 l of ligation reaction (see Recombination and Host Strains for Subcloning and Propagation). Plate transformation reactions on LBampicillin agar plates (see Preparation of Media and Reagents).

pFB and pFB-Neo Retroviral Vectors 9

RECOMBINATION AND HOST STRAINS FOR SUBCLONING AND PROPAGATION

Retroviral vectors are more likely to experience recombination events than other plasmid vectors because of repeat sequences in the LTR regions. We offer RecA E. coli strains such as XL10-Gold ultracompetent cells or XL1- Blue supercompetent cells which address this issue.

PRIMERS The nucleotide sequence and vector coordinates for primers suitable for PCR amplification and sequencing of inserts in the pFB and pFB-Neo vectors are as follows:

Primer Coordinates (bp) Sequence

5 Retro 20082028 5-GGCTGCCGACCCCGGGGGTGG-3

3 pFB 21212101 5-CGAACCCCAGAGTCCCGCTCA-3

3 pFB-Neo 21472127 5-GCCAGGTTTCCGGGCCCTCAC-3

10 pFB and pFB-Neo Retroviral Vectors

PREPARATION OF MEDIA AND REAGENTS

LB Agar (per Liter) 10 g of NaCl 10 g of tryptone 5 g of yeast extract 20 g of agar Add deionized H2O to a final volume of

1 liter Adjust pH to 7.0 with 5 N NaOH Autoclave Pour into petri dishes

(~25 ml/100-mm plate)

LBAmpicillin Agar (per Liter) 1 liter of LB agar, autoclaved Cool to 55C Add 10 ml of 10-mg/ml filter-sterilized

ampicillin Pour into petri dishes

(~25 ml/100-mm plate)

TE Buffer 10 mM Tris-HCl (pH 7.5) 1 mM EDTA

10 Ligase Buffer 500 mM Tris-HCl (pH 7.5) 70 mM MgCl2 10 mM DTT

Note rATP is added separately in the ligation reaction.

REFERENCES 1. Miller, A. D. (1997). Development and Applications of Retroviral Vectors.

In Retroviruses, J. M. Coffin, S. H. Hughes and H. E. Varmus (Eds.), pp. 437-473. Cold Spring Harbor Laboratory Press, Plainview, NY.

2. Felts, K., Bauer, J. C. and Vaillancourt, P. (1999) Strategies 12(2):74-77.

SUPPLEMENTAL REFERENCES 1. Miller, A. D. (1997) Development and Applications of Retroviral Vectors.

In Retroviruses (eds., Coffin, J. M., Hughes, S. H., and Varmus, H. E.) pp. 437473. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.

2. Cepko, C., and Pear, W. (1996) In Current Protocols in Molecular Biology, pp. 9.9.19.9.16. John Wiley & Sons Inc., New York.

MSDS INFORMATION Mat

Manualsnet FAQs

If you want to find out how the pFB Agilent works, you can view and download the Agilent pFB Vector Instruction Manual on the Manualsnet website.

Yes, we have the Instruction Manual for Agilent pFB as well as other Agilent manuals. All you need to do is to use our search bar and find the user manual that you are looking for.

The Instruction Manual should include all the details that are needed to use a Agilent pFB. Full manuals and user guide PDFs can be downloaded from Manualsnet.com.

The best way to navigate the Agilent pFB Vector Instruction Manual is by checking the Table of Contents at the top of the page where available. This allows you to navigate a manual by jumping to the section you are looking for.

This Agilent pFB Vector Instruction Manual consists of sections like Table of Contents, to name a few. For easier navigation, use the Table of Contents in the upper left corner.

You can download Agilent pFB Vector Instruction Manual free of charge simply by clicking the “download” button in the upper right corner of any manuals page. This feature allows you to download any manual in a couple of seconds and is generally in PDF format. You can also save a manual for later by adding it to your saved documents in the user profile.

To be able to print Agilent pFB Vector Instruction Manual, simply download the document to your computer. Once downloaded, open the PDF file and print the Agilent pFB Vector Instruction Manual as you would any other document. This can usually be achieved by clicking on “File” and then “Print” from the menu bar.